carcinogenicity comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Last reviewed on 2026-01-21. Where a claim depends on a specific study, the study is described rather than over-claimed.
Anti-doping laboratories identify GW501516 and related metabolites using liquid chromatography coupled with tandem mass spectrometry. Urine is the most common matrix, though blood and dried blood spots may also be analyzed. The method targets the parent compound and phase I and phase II metabolites, which extend the detection window. Because the substance is prohibited at all times, athletes can be tested outside competition. Detection limits and windows depend on the assay, sample type, and individual metabolism.
Cardarine is frequently described as a fat-burning or endurance-enhancing supplement, but these claims exceed the available evidence. The compound is not a hormone, steroid, or selective androgen receptor modulator. Research articles discuss it as a tool compound for studying PPARδ biology, while anti-doping literature focuses on its abuse and detection. Quality of unapproved products is uncertain, and independent analyses have found impurities or incorrect labeling. Open questions include whether human cancer risk resembles that seen in rodents and how often non-athletes use the substance.
Human trials of GW501516 were small and short in duration. They examined lipid levels, glucose handling, and other metabolic markers, but the programs were halted after the animal cancer findings. No approved therapeutic product exists, and published human data are insufficient for establishing long-term safety. Reports of use for athletic performance come mainly from non-clinical settings and cannot be verified through controlled trials. Independent testing of products sold as cardarine has found inconsistent purity and labeling.
Laboratory studies indicate that GW501516 activates PPARδ, a nuclear receptor involved in fatty acid oxidation and energy metabolism. In rodent experiments, treated animals often showed increased endurance and reduced fat mass. These effects were observed under controlled conditions and do not establish safe or effective use in humans. The exact dose-response relationship in humans remains poorly characterized. Species differences in metabolism can affect how results translate across animals and people.
Safety concerns emerged from long-term animal studies. In rodents given the compound for extended periods, researchers found an increased incidence of certain cancers, including liver and bladder tumors. These findings contributed to the discontinuation of clinical development. Whether similar risks apply to short-term or low-level exposure in humans is not established, and controlled human safety data are limited. The relevance of high-dose rodent carcinogenicity findings to human use remains a subject of debate.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Prohibited in sport; not approved as medicine | Listed by WADA at all times. |
| Common synonyms | GW501516, GW-501516, endurobol | Cardarine is a colloquial name. |
| Typical analytical method | LC-MS/MS | Detects parent compound and metabolites. |
| Common test matrix | Urine | Blood and dried blood spots also possible. |
| Legal classification | Varies by country | Often treated as unapproved drug or research chemical. |
Sporting authorities added GW501516 to prohibited lists after it appeared in athlete samples and online markets. The World Anti-Doping Agency classifies it as a hormone and metabolic modulator, and its use can lead to an anti-doping rule violation. Some early laboratory work suggested effects on fatty acid oxidation and endurance-related metabolism in animals, but those findings do not establish safe or effective use in people. Reports of adverse events in humans are scarce and often anecdotal, which complicates risk assessment.
Legal status varies by country. In some places, cardarine is controlled under medicines or psychoactive substances laws; in others, it may be sold with minimal oversight as a research chemical. Customs agencies have intercepted shipments, and several national health agencies have issued warnings about products marketed for bodybuilding or performance enhancement. The lack of a standardized pharmaceutical supply means identity, purity, and contamination levels can differ widely between samples. These factors make cardarine a regulatory and public health concern rather than a conventional prescription drug.
GW501516 acts as an agonist at peroxisome proliferator-activated receptor delta, a nuclear receptor involved in transcription of genes related to lipid handling and energy use. Activation of PPARδ can shift skeletal muscle toward greater fatty acid oxidation in animal models, which is one reason it drew interest for metabolic disease and exercise research. The exact downstream effects depend on tissue, species, dose, and duration. Human data are sparse, so many proposed benefits remain hypotheses rather than established clinical outcomes.
Laboratory studies have examined GW501516 in cell cultures and rodents for conditions such as dyslipidemia, insulin resistance, and obesity. Some trials in humans were initiated, but development was discontinued after preclinical findings raised concerns about cancer in certain models. Those findings do not prove that the compound causes cancer in people, but they contributed to regulatory caution. Later reviews often describe the evidence as preliminary and insufficient for assessing long-term safety.
In the close vicinity of Schwarzau castle was the Villa Wartholz, residence of Archduchess Maria Theresa of Austria, Zita's maternal aunt. She was the stepmother of Archduke Otto, who died in 1906, and the step-grandmother of Archduke Charles of Austria-Este, at that time second-in-line to the Austrian throne. The two daughters of Archduchess Maria Theresa were Zita's first cousins and Charles' half-aunts. They had met as children but did not see one another for almost ten years, as each pursued their education. In 1909, his Dragoon regiment was stationed at Brandýs nad Labem, from where he visited his aunt at Františkovy Lázně. It was during one of these visits that Charles and Zita became reacquainted. Charles was under pressure to marry (Franz Ferdinand, his uncle and first-in-line, had married morganatically, and his children were excluded from the throne) and Zita had a suitably royal genealogy. Zita later recalled:
Abiogenesis – Life arising from non-living matter Brine pool – Accumulation of brine in a seafloor depression Endeavour Hydrothermal Vents – Group of Pacific Ocean hydrothermal vents Extremophiles – Organisms capable of living in extreme environmentsPages displaying short descriptions of redirect targets Hydrogen sulfide chemosynthesis - system of generating energy used in hydrothermal vents Lost City Hydrothermal Field Magic Mountain (British Columbia) – Hydrothermal vent field in the northeast Pacific 9° North – Region of hydrothermal vents on the East Pacific Rise in the Pacific Ocean Pito Seamount – Seamount in the Pacific Ocean north-northwest of Easter Island Submarine volcano – Underwater vents or fissures in the Earth's surface from which magma can erupt Volcanogenic massive sulfide ore deposit, also known as VMS deposit – Metal sulfide ore deposit Deep sea mining
=== Visual arts === North Carolina Museum of Art, occupying a large suburban campus on Blue Ridge Road near the North Carolina State Fairgrounds, maintains one of the premier public art collections located between Washington, D.C., and Atlanta. In addition to its extensive collections of American Art, European Art and ancient art, the museum recently has hosted major exhibitions featuring Auguste Rodin (in 2000) and Claude Monet (in 2006–07), each attracting more than 200,000 visitors. Unlike most prominent public museums, the North Carolina Museum of Art acquired a large number of the works in its permanent collection through purchases with public funds. The museum's outdoor park is one of the largest such art parks in the country. The museum facility underwent a major expansion which greatly expanded the exhibit space that was completed in 2010. The 127,000 sf new expansion is designed by NYC architect Thomas Phifer and Partners. Raleigh's downtown is also home to many local art galleries such as Art Space in City Market, Visual Art Exchange, and 311 Gallery, on Martin Street, and Bee Hive Studios on Hargett Street. CAM Raleigh is a downtown contemporary art museum, also on Martin Street, that serves to promote new artists and does not house a permanent collection. CAM Raleigh was designed by the award-winning architectural firm Brooks+Scarpa of Los Angeles.
A probable diagnosis is based on the history of the illness and cognitive testing, with medical imaging and blood tests to rule out other possible causes. Initial symptoms are often mistaken for normal brain aging. Examination of brain tissue is the only way to definitively diagnose Alzheimer's, but neuroimaging techniques and fluid biomarkers have made it possible to diagnose probable Alzheimer's disease in vivo. No known treatments can stop or reverse its progression, though some may temporarily improve symptoms. A healthy diet, physical activity, and social engagement are generally beneficial in aging, and may help in reducing the risk of cognitive decline and Alzheimer's. Affected people become increasingly reliant on others for assistance, often placing a burden on caregivers. The pressures can include social, psychological, physical, and economic elements. Exercise programs may be beneficial with respect to activities of daily living and can potentially improve outcomes. Behavioral problems or psychosis due to dementia are sometimes treated with antipsychotics, but this has an increased risk of early death. As of 2020, there were approximately 50 million people worldwide with Alzheimer's disease. It most often begins in people over 65 years of age, although up to 10% of cases are early-onset impacting those in their 30s to mid-60s. It affects about 6% of people 65 years and older, and women more often than men. The disease is named after German psychiatrist and pathologist Alois Alzheimer, who first described it in 1906.
Sydenham's chorea, also known as rheumatic chorea, is a disorder characterized by rapid, uncoordinated jerking movements primarily affecting the face, hands and feet. Sydenham's chorea is an autoimmune disease that results from childhood infection with Group A beta-haemolytic Streptococcus. It is reported to occur in 20–30% of people with acute rheumatic fever and is one of the major criteria for it, although it sometimes occurs in isolation. The disease occurs typically a few weeks, but up to 6 months, after the acute infection, which may have been a simple sore throat (pharyngitis). Sydenham's chorea is more common in females than males, and most cases affect children between 5 and 15 years of age. Adult onset of Sydenham's chorea is comparatively rare, and the majority of the adult cases are recurrences following childhood Sydenham's chorea (although pregnancy and female hormone treatment are also potential causes). It is historically one of the conditions called St Vitus' dance.
Sources: en.wikipedia.org
=== Drugs of abuse === Synthetic cannabinoids Cocaine LSD Opiates (e.g., fentanyl, oxycodone, heroin, codeine, and morphine) Amphetamines (e.g., MDMA (Ecstasy), MDA, Meth) "Bath salts" (e.g., cathinone, synthetic cathinone, MDPV) GHB Phencyclidine (PCP)
In 2009, the indications were expanded to include the prophylaxis of transplant rejection in adult and paediatric, kidney, liver or heart allograft recipients and the treatment of allograft rejection resistant to treatment with other immunosuppressive medicinal products in adults and children.
=== Activation process (canonical/classical) === Activation of the NF-κB is initiated by the signal-induced degradation of IκB proteins. This occurs primarily via activation of a kinase called the IκB kinase (IKK). IKK is composed of a heterodimer of the catalytic IKKα and IKKβ subunits and a "master" regulatory protein termed NEMO (NF-κB essential modulator) or IKKγ. When activated by signals, usually coming from the outside of the cell, the IκB kinase phosphorylates two serine residues located in an IκB regulatory domain. When phosphorylated on these serines (e.g., serines 32 and 36 in human IκBα), the IκB proteins are modified by a process called ubiquitination, which then leads them to be degraded by a cell structure called the proteasome. With the degradation of IκB, the NF-κB complex is then freed to enter the nucleus where it can 'turn on' the expression of specific genes that have DNA-binding sites for NF-κB nearby. The activation of these genes by NF-κB then leads to the given physiological response, for example, an inflammatory or immune response, a cell survival response, or cellular proliferation. Translocation of NF-κB to nucleus can be detected immunocytochemically and measured by laser scanning cytometry. NF-κB turns on expression of its own repressor, IκBα. The newly synthesized IκBα then re-inhibits NF-κB and, thus, forms an auto feedback loop, which results in oscillating levels of NF-κB activity.
Genetically modified organisms are regulated by government agencies. This applies to research as well as the release of genetically modified organisms, including crops and food. The development of a regulatory framework concerning genetic engineering began in 1975, at Asilomar, California. The Asilomar meeting recommended a set of guidelines regarding the cautious use of recombinant technology and any products resulting from that technology. The Cartagena Protocol on Biosafety was adopted on 29 January 2000 and entered into force on 11 September 2003. It is an international treaty that governs the transfer, handling, and use of genetically modified organisms. One hundred and fifty-seven countries are members of the Protocol and many use it as a reference point for their own regulations. Universities and research institutes generally have a special committee that is responsible for approving any experiments that involve genetic engineering. Many experiments also need permission from a national regulatory group or legislation. All staff must be trained in the use of GMOs and all laboratories must gain approval from their regulatory agency to work with GMOs. The legislation covering GMOs are often derived from regulations and guidelines in place for the non-GMO version of the organism, although they are more severe. There is a near-universal system for assessing the relative risks associated with GMOs and other agents to laboratory staff and the community.
Sources: en.wikipedia.org
== Legal status == Japan was the first country that allowed the use of sucrose esters as food additives. The Japanese Ministry of Health and Welfare approved sucrose esters in 1959. Then, in 1969, FAO/WHO approved the use of sucrose esters. Sucrose esters were approved and registered by European Food Safety Authority or EFSA under the E number of E 473. In the US, sucrose esters were approved by the FDA (Food and Drug Administration).
=== Mass spectrometry imaging === By continuously scanning a surface, such as tissue section, nano-DESI can be used for imaging. By carefully choosing the experimental conditions, such as the nano-DESI solvent, additives, and the ionization mode (positive or negative) we can map the distribution of a wide variety of complex molecules on different surfaces. A few examples to mention are proteins, lipids, small metabolites, drugs or even the distribution of endogenous alkali metals. Nano-DESI has been applied for localized analysis of complex molecules and imaging of tissue sections, microbial communities and environmental samples.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
Legal status varies by country. It is not approved as a medicine, and it is prohibited in sport. Some jurisdictions restrict import, sale, or possession.
Laboratories use liquid chromatography-tandem mass spectrometry to detect GW501516 and its metabolites. Urine is commonly tested, and testing can occur in and out of competition.
No, cardarine is not a SARM. It is a PPARδ agonist, which acts on a different receptor. The two classes are often confused in online discussions.
Rodent studies reported increased endurance and fat oxidation after GW501516 exposure. Long-term studies also found higher rates of some tumors, which led to halted development.